Home | Background | Resources | Credits | Contact | Help | G-Quadruplex Portal Site
QGRS Mapper 2 | Research Tools
QGRS Search Options  Max length:   Min G-group:   HELPMax QGRS Length (default is 30)

You can limit the maximum length of the QGRS sequences. The shortest possible QGRS is 10 nucleotides.


Minimum G-Group size (default is 2)

The minimum number of tetrads in a G-quadruplex. For instance, QGRS with G-group size of 4 might look like:

GGGGGAGGGGTGGGGGCTAGGGG    Loop size: to   Loops contain:   HELPLoop size (default is from 0 to 36)

The user may specify a range of possible lengths for the loops. The range will apply to all three loops of the QGRS. By default, it will search for any loops.

Loops that contain sequence

You can specify a nucleotide sequence that at least one of the loops must contain. You can also specify a regular expression. For instance, a{4,} will search for loops with 4 or more consecutive A's.

mRNA Search

Analyze a gene by NCBI Entrez Gene ID (ex: 67997): HELPNCBI Gene ID

This field allows you to input the NCBI Entrez Gene ID if known. To obtain ID for the gene of interest, query the NCBI website (click on the Entrez Gene Link) using Gene Name or a standard Gene Symbol.

Click the 'Analyze' button after entering a valid ID. QGRS Mapper will automatically download the nucleotide sequence of the gene and analyze it for QGRS sequences.

Alternatively, you can use the other fields below to search the NCBI with Gene Name or Symbol.
Search genes by gene name or gene symbol (ex: BDNF): HELPGene name or symbol

This field will allow you to search the NCBI databases for genes by their names or symbols.

Click the 'Analyze' button after entering a valid value. QGRS Mapper will automatically download the nucleotide sequence of the gene and analyze it for QGRS sequences.

You can use complex expressions like glyc* to perform a fuzzy search and obtain a list of gene names that match your string. Up to 500 genes will be displayed.
Search genes by NCBI nucleotide accession number (ex: NM_000015.1): HELPNucleotide Number

This will list all the mRNAs with the supplied accession number.

Click on 'GO' for the appropriate mRNA in the results table to submit it for analysis by QGRS Mapper 2.
Home | Analyze | Background | Resources | Credits | Contact | Help