Home | Analyze | Background | Resources | Credits | Contact | Help

QGRS Mapper Help: QGRS Definition

QGRS Definition | Search & Analysis | Loop Search Options | Understanding G-Scores | Dealing with overlaps | Glossary


The goal of the QGRS Mapper program is to predict the presence of Quadruplex forming G Rich Sequences (QGRS) in nucleotide entries. These putative G-quadruplexes are identified using the following motif.

GxNy1GxNy2GxNy3Gx

Here x = # guanine tetrads in the G-quadruplex and y1, y2, y3 = length of gaps (that is, the length of the loops connecting the guanine tetrads). So the motif consists of four equal length groups of guanines, separated by arbitrary nucleotide sequences, with the following restrictions. This table shows some examples of valid QGRS. The guanine groups which form the tetrads are underlined.
1. GGACGGGGTTTGG
2. GGGTGGGTGGCAGAGCTGGGCTGGG
3. GGGGTGGGGTGGGGTGGGG
x=2, y1=2, y2=0, y3=3
x=3, y1=1, y2=10, y3=2
x=4, y1=1, y2=1, y3=1

The first sequence has four tetrads and equal length gaps. This would seem to provide the most stable G-quadruplex. The second sequence is notable for the significant differences in the size of its loops. The third sequence has two tetrads, even though three of the G-groups could have included another G (since all G-groups must be equal in size).
Home | Analyze | Background | Resources | Credits | Contact | Help
 
Visitors