QGRS Search Options  Max length: 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10   Min G-group: 2 3 4 5 6   HELPMax QGRS Length (default is 30) You can limit the maximum length of the QGRS sequences. The shortest possible QGRS is 10 nucleotides. Minimum G-Group size (default is 2) The minimum number of tetrads in a G-quadruplex. For instance, QGRS with G-group size of 4 might look like: GGGGGAGGGGTGGGGGCTAGGGG    Loop size: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 to 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36   Loops contain:   HELPLoop size (default is from 0 to 36) The user may specify a range of possible lengths for the loops. The range will apply to all three loops of the QGRS. By default, it will search for any loops. Loops that contain sequence You can specify a nucleotide sequence that at least one of the loops must contain. You can also specify a regular expression. For instance, a{4,} will search for loops with 4 or more consecutive A's.