Home | Background | Resources | Credits | Contact | Help | G-Quadruplex Portal Site

QGRS Mapper Help: Loop Search Options

QGRS Definition | Search & Analysis | Loop Search Options | Understanding G-Scores | Dealing with overlaps | Glossary


QGRS Mapper allows the user to search for QGRS with specific loop characteristics (loops connect the G-tetrads in the G-quadruplex). The user may restrict the search by specifying loop size or loop composition. Combining these two search options gives the user a variety of ways to analyze QGRS.

Loop Size

The user may specify a range of possible lengths for the loops. The range will apply to all three loops of the QGRS. The default range is from 0 to 36.

Examples:

1 

will return only the QGRS whose loops are 1 to 5 nucleotides long. This means that all three loops will have lengths in this range. To search for QGRS with one or more loops with lengths in this range, see example (14) below. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 73 QGRS with loops of length from 1 to 5.

2 

will return only the QGRS with three loops of length 1. To search for QGRS with one or more loops of length 1, see example (15) below. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are only 13 QGRS with loops of length 1.

Loop Composition

The user may specify the composition of the loops. The program will return QGRS which have at least one loop with the specified composition. The user may specify the exact composition of the loop or use a regular expression to look for loops matching a certain pattern.

There are many online resources available to learn how to use regular expressions. For a fast introduction see the article by Dario Gomes:
http://www.phpbuilder.com/columns/dario19990616.php3

Let us look at some examples of loop composition searches.

3 

will search for QGRS with one or more loops containing the sequence "TAT". For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are only 27 QGRS that have a loop containing "TAT".

4 

will search for QGRS with one or more loops that start with "TAT". The symbol ^ refers to the beginning of a string. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are only 7 QGRS that have a loop starting with "TAT".

5 

will search for QGRS with one or more loops that end with "TAT". The symbol $ refers to the end of a string. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are only 2 QGRS that have a loop ending with "TAT".

6 

will search for QGRS with one or more loops that exactly match "TAT. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there is only 1 QGRS that have a loop exactly matching "TAT" (this is the sequence GGACCAAATACTGAGAAGGCCAGGGTATGG).

7 

will search for QGRS with one or more loops containing a sequence that consists of a T or G followed by "AT". For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 68 QGRS that have a loop containing a T or G followed by "AT".

8 

will search for QGRS with one or more loops containing a sequence that consists of a T followed by a nucleotide that is not an A followed by a T. In this context, the symbol '^' means not. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 106 QGRS that have a loop containing a T followed by a non-A followed by a T.

9 

will search for QGRS with one or more loops containing the sequence "TA" followed by 0 or more T's (so "TA", "TAT", "TATT" would all be valid matches). The symbol '*' means 0 or more occurrences. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 124 QGRS that have a loop containing "TA" followed by 0 or more T's.

10 

will search for QGRS with one or more loops containing the sequence "TAT" followed by 1 or more A's (so "TATA", "TATAA" would be valid matches, but "TAT" is not). The symbol '+' means 1 or more occurrences. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 3 QGRS that have a loop containing "TAT" followed by 1 or more A's.

11 

will search for QGRS with one or more loops containing the sequence "TAT" followed by 0 or 1 A's (so "TAT", "TATA" would be valid matches, but "TATAA" is not). The symbol '?' means 0 or 1 occurrences. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 27 QGRS that have a loop containing "TAT" followed by 0 or 1 A's.

12 

will search for QGRS with one or more loops that have 2 or more consecutive T's. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 131 QGRS that have a loop containing 2 or more consecutive T's.

13 

will search for QGRS with one or more loops that contain 3 to 5 consecutive T's. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 48 QGRS that have a loop containing 3 to 5 consecutive T's.

14 

will search for QGRS with one or more loops that contain 1 to 5 nucleotides. The period represents any character (QGRS Mapper itself only considers the characters G,C,A,T,U,N). For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 205 QGRS that have a loop containing 1 to 5 nucleotides.

15 

will search for QGRS with one or more loops that contain exactly 1 nucleotide. The period represents any character. For example, the human BDNF gene contains 215 non-overlapping QGRS. But there are 122 QGRS that have a loop containing exactly 1 nucleotide.

Home | Analyze | Background | Resources | Credits | Contact | Help