QGRS Mapper Help: QGRS Definition

QGRS Definition | Search & Analysis | Loop Search Options | Understanding G-Scores | Dealing with overlaps | Glossary

The goal of the QGRS Mapper program is to predict the presence of Quadruplex forming G Rich Sequences (QGRS) in nucleotide entries. These putative G-quadruplexes are identified using the following motif.

G_xN_y1G_xN_y2G_xN_y3G_x

Here x = # guanine tetrads in the G-quadruplex and y₁, y₂, y₃ = length of gaps (that is, the length of the loops connecting the guanine tetrads). So the motif consists of four equal length groups of guanines, separated by arbitrary nucleotide sequences, with the following restrictions.

• The sequence must contain at least two tetrads (i.e., x≥2). Although structures with three or more G-tetrads are considered to be more stable, many nucleotide sequences are known to form quadruplexes with two G-tetrads. QGRS Mapper is meant to be a flexible and comprehensive tool for investigating G-quadruplexes; hence it considers sequences with two tetrads.


• By default, only QGRS of maximum length of 30 bases are considered. However, the program gives the user the option to search for sequences up to 45 bases. This restriction on the length of the sequences being considered is in agreement with recent literature. The maximum length of 30 bases restricts G-groups to a maximum size of 6.


• Also, at most one of the gaps is allowed to be of zero length.

This table shows some examples of valid QGRS. The guanine groups which form the tetrads are underlined.

1. GGACGGGGTTTGG 2. GGGTGGGTGGCAGAGCTGGGCTGGG 3. GGGGTGGGGTGGGGTGGGG

x=2, y1=2, y2=0, y3=3 x=3, y1=1, y2=10, y3=2 x=4, y1=1, y2=1, y3=1

The first sequence has four tetrads and equal length gaps. This would seem to provide the most stable G-quadruplex. The second sequence is notable for the significant differences in the size of its loops. The third sequence has two tetrads, even though three of the G-groups could have included another G (since all G-groups must be equal in size).