Home | Background | Resources | Credits | Contact | Help | G-Quadruplex Portal Site

QGRS Mapper Help: Understanding G-Scores

QGRS Definition | Search & Analysis | Loop Search Options | Understanding G-Scores | Dealing with overlaps | Glossary


We have devised a scoring system that evaluates a QGRS for its likelihood to form a stable G-quadruplex. Higher scoring sequences will make better candidates for G-quadruplexes. The scoring method uses the following principles which are based on published work.

Using these precepts, the first sequence in following Table should have the largest score. The scoring system assigns a nonnegative integer, which we call the G-score, to a QGRS.

QGRS G-Score
GGGGTGGGGTGGGGTGGGG
GGGTGGGTGGCAGAGCTGGGCTGGG
GGGCGGGCTGGGTTGG
63
33
20

Note:
The computed G-scores are dependent on the user selected maximum QGRS length. The highest possible G-score, using the default maximum QGRS length of 30, is 105. Here is a sequence attaining that score: GGGGGGTGGGGGGTGGGGGGTGGGGGG.

Home | Analyze | Background | Resources | Credits | Contact | Help