Switch to GRS_UTRdb

   

GRSDB Help: Understanding G-Scores

1. QGRS Definition
2. Search & Analysis
3. Workbench Help
4. Understanding G-Scores
5. Dealing with overlaps
6. Glossary

We have devised a scoring system that evaluates a QGRS for its likelihood to form a stable G-quadruplex. Higher scoring sequences will make better candidates for G-quadruplexes. The scoring method uses the following principles which are based on published work.

• Shorter loops are more common than longer loops.
• G-quadruplexes tend to have loops roughly equal in size.
• The greater the number of guanine tetrads, the more stable the quadruplex.

Using these precepts, the first sequence in following Table should have the largest score. The scoring system assigns a nonnegative integer, which we call the G-score, to a QGRS.

QGRS	G-Score
GGGGTGGGGTGGGGTGGGG GGGTGGGTGGCAGAGCTGGGCTGGG GGGCGGGCTGGGTTGG	63 33 20

Note:
The computed G-scores are dependent on the user selected maximum QGRS length. The highest possible G-score, using the default maximum QGRS length of 30, is 105. Here is a sequence attaining that score: GGGGGGTGGGGGGTGGGGGGTGGGGGG.