Switch to GRS_UTRdb

   

GRSDB Help: QGRS Definition

1. QGRS Definition
2. Search & Analysis
3. Workbench Help
4. Understanding G-Scores
5. Dealing with overlaps
6. Glossary

GRSDB allows the user to analyze the transcribed regions of eukaryotic pre-mRNA sequences with respect to information about the composition of Quadruplex forming G Rich Sequences (QGRS) and their location relative to the RNA processing sites. These putative G-quadruplexes are identified using the following motif.

G_xN_y1G_xN_y2G_xN_y3G_x

Here x = # guanine tetrads in the G-quadruplex and y₁, y₂, y₃ = length of gaps (that is, the length of the loops connecting the guanine tetrads). So the motif consists of four equal length groups of guanines, separated by arbitrary nucleotide sequences, with the following restrictions:

• The sequence must contain at least two tetrads (i.e., x=2). Although structures with three or more G-tetrads are considered to be more stable, many nucleotide sequences are known to form quadruplexes with two G-tetrads.


• QGRS lengths are restricted to 30 or 45 nucleotides.


• Also, at most one of the gaps is allowed to be of zero length.

This table shows some examples of valid QGRS. The guanine groups which form the tetrads are underlined.

1. GGACGGGGTTTGG 2. GGGTGGGTGGCAGAGCTGGGCTGGG 3. GGGGTGGGGTGGGGTGGGG

x=2, y1=2, y2=0, y3=3 x=3, y1=1, y2=10, y3=2 x=4, y1=1, y2=1, y3=1

The first sequence has four tetrads and equal length gaps. This would seem to provide the most stable G-quadruplex. The second sequence is notable for the significant differences in the size of its loops. The third sequence has two tetrads, even though three of the G-groups could have included another G (since all G-groups must be equal in size).

Note:
There are two categories of QGRS that are referred to in GRSDB:

1. (30,2) denotes all QGRS of length at most 30 nucleotides and having at least 2 G’s per G-group
2. (45,3) denotes all QGRS of length at most 45 and having at least 3 G’s per G-group.