GRSDB Help

Computing G-Scores

A scoring method is applied to each QGRS. The computed score, called a G-score (1), rewards sequences with larger G-groups (2 G's per groups is a minimum), smaller gaps and more even gaps between the G-groups. The properties of the scoring system can be seen from the table below, adapted from the ACPT gene in GRSDB. In this table, the groups of G's making up the G-quadruplex are shown in bold.

Some comments on this example.

The fourth sequence has a G-group of 3 G's, hence its higher score than the other sequences, which have G-groups of 2 G's.
A sequence having 2 G's in each G-group will have a maximum G-score of 1. The third sequence in the table attains this score (all gaps are of size 2).
The second sequence has the lowest score, this follows from the fact that its gap lengths (10, 1, 1) are quite uneven.
The first and fourth sequences use a zero gap (i.e., a gap of zero length). At most one such gap is allowed in the sequence.

Sample QGRS in Exons of Product 1 of gene ACPT

Exon Number	QGRS Position	Distance from 3' or 5' ss	QGRS	G-Score
1	1325	3:2	GGCCGGCCTGGGG	0.83333
1	1546	5:60	GGACCCACACAAGGAGGTGG	0.50000
4	3067	5:12	GGAGGG CTGG ACGG	1.00000
10	6034	3:83	GGG TGCCTGCGGG CCTTGGGGGG	1.81219

This choice of scoring system is in agreement with the existing literature on loop structures in G-quadruplexes. In particular, the data gathered in this research points to loop sizes tending to be small and preferentially equal or nearly equal.

1.D'Antonio,L. and Bagga,P.S. (2004) Computational methods for predicting intramolecular G-quadruplexes in nucleotide sequences. Computational Systems Bioinformatics, CSB 2004. Proceedings . 2004 IEEE, Pages:561-562.

Search Help

Glossary of terms

Understanding G-Scores

Dealing with overlaps

Home Browse Search Resources Credits Statistics Help Top